pYZ_NAND2_L17_S19_S11
(Plasmid
#132730)
-
PurposeT7 RNAP-driven expression of a 2-input NAND gate RNA with a GFP-ASV reporter that binds to 3WJ repressor trigger indices 19 and 11
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132730 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCOLAduet
- Backbone size w/o insert (bp) 3224
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3WJ_NAND2_L17_S19_S11
-
SpeciesSynthetic
-
Insert Size (bp)1057
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTTACTGGTTTCACATTCACCACCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The output gene is GFPmut3b with an ASV degradation tag. Please visit https://www.biorxiv.org/content/10.1101/501783v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYZ_NAND2_L17_S19_S11 was a gift from Alexander Green & Peng Yin (Addgene plasmid # 132730 ; http://n2t.net/addgene:132730 ; RRID:Addgene_132730) -
For your References section:
De novo-designed translation-repressing riboregulators for multi-input cellular logic. Kim J, Zhou Y, Carlson PD, Teichmann M, Chaudhary S, Simmel FC, Silver PA, Collins JJ, Lucks JB, Yin P, Green AA. Nat Chem Biol. 2019 Dec;15(12):1173-1182. doi: 10.1038/s41589-019-0388-1. Epub 2019 Nov 4. 10.1038/s41589-019-0388-1 PubMed 31686032