Skip to main content

pABM-D4-miR30-L1221
(Plasmid #132933)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132933 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pABM-D4-miR30
  • Vector type
    Lentiviral, RNAi
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    luciferase shRNA
  • gRNA/shRNA sequence
    TACAAACGCTCTCATCGACAAG
  • Species
    H. sapiens (human)
  • Promoter SFFV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pABM-D4-miR30-L1221 was a gift from Jeremy Luban (Addgene plasmid # 132933 ; http://n2t.net/addgene:132933 ; RRID:Addgene_132933)
  • For your References section:

    Cyclophilin A protects HIV-1 from restriction by human TRIM5alpha. Kim K, Dauphin A, Komurlu S, McCauley SM, Yurkovetskiy L, Carbone C, Diehl WE, Strambio-De-Castillia C, Campbell EM, Luban J. Nat Microbiol. 2019 Dec;4(12):2044-2051. doi: 10.1038/s41564-019-0592-5. Epub 2019 Oct 21. 10.1038/s41564-019-0592-5 PubMed 31636416