pYZ675
(Plasmid
#132954)
-
PurposecrRNA entry vector of Pfba1-BsaI pad-TEF1 Term with dFnCas12a Schizosaccharomyces pombe
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132954 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepombe ars1/ura4
- Backbone size w/o insert (bp) 7454
- Total vector size (bp) 12514
-
Vector typeCRISPR, Synthetic Biology
-
Selectable markersSpura4
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Growth instructions30°C recommended for this large plasmid. 37°C may also be fine for bacteria growth.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedFnCas12a
-
Alt namedFnCpf1
-
gRNA/shRNA sequenceN/A
-
SpeciesH. sapiens (human)
- Promoter adh1
-
Tag
/ Fusion Protein
- nucleoplasmin NLS (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CAGTGCCCTACAACAACTAAGAAAATGG
- 3′ sequencing primer GGGGATCGCAAATTAAAGCCTTCGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYZ675 was a gift from Jef Boeke (Addgene plasmid # 132954 ; http://n2t.net/addgene:132954 ; RRID:Addgene_132954) -
For your References section:
CRISPR-Cas12a system in fission yeast for multiplex genomic editing and CRISPR interference. Zhao Y, Boeke JD. Nucleic Acids Res. 2020 Jun 4;48(10):5788-5798. doi: 10.1093/nar/gkaa329. 10.1093/nar/gkaa329 PubMed 32374858