pCAGGS::AtHAP2-V5
(Plasmid
#132958)
-
PurposeExpress AtHAP2 full length protein in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132958 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 4741
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAtHAP2
-
Alt nameAt GCS1
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)2172
-
GenBank ID826777
-
Entrez GeneGCS1 (a.k.a. AT1G67490, KNF, KNOPF, T1F15.4, T1F15_4, glucosidase 1)
-
Entrez GeneHAP2 (a.k.a. AT4G11720, GCS1, GENERATIVE CELL-SPECIFIC 1, HAPLESS 2, T5C23.150, T5C23_150)
-
Tag
/ Fusion Protein
- V5 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer GCAACGTGCTGGTTATTGTGCTGTC
- 3′ sequencing primer TCCCATATGTCCTTCCGAGTGA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe A. thaliana HAP2 plasmids were derived from AtHAP2promoter::HAP2cds::YFP (PGL290; GenBank AF234315; von Besser et al., 2006) that fully rescues hap2(−) A. thaliana mutants (Wong et al., 2010).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS::AtHAP2-V5 was a gift from Benjamin Podbilewicz (Addgene plasmid # 132958 ; http://n2t.net/addgene:132958 ; RRID:Addgene_132958) -
For your References section:
Arabidopsis HAP2/GCS1 is a gamete fusion protein homologous to somatic and viral fusogens. Valansi C, Moi D, Leikina E, Matveev E, Grana M, Chernomordik LV, Romero H, Aguilar PS, Podbilewicz B. J Cell Biol. 2017 Mar 6;216(3):571-581. doi: 10.1083/jcb.201610093. Epub 2017 Jan 30. 10.1083/jcb.201610093 PubMed 28137780