Skip to main content

pCAGGS::AtHAP2-V5
(Plasmid #132958)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132958 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAGGS
  • Backbone size w/o insert (bp) 4741
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AtHAP2
  • Alt name
    At GCS1
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    2172
  • GenBank ID
    826777
  • Entrez Gene
    GCS1 (a.k.a. AT1G67490, KNF, KNOPF, T1F15.4, T1F15_4, glucosidase 1)
  • Entrez Gene
    HAP2 (a.k.a. AT4G11720, GCS1, GENERATIVE CELL-SPECIFIC 1, HAPLESS 2, T5C23.150, T5C23_150)
  • Tag / Fusion Protein
    • V5 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer GCAACGTGCTGGTTATTGTGCTGTC
  • 3′ sequencing primer TCCCATATGTCCTTCCGAGTGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The A. thaliana HAP2 plasmids were derived from AtHAP2promoter::HAP2cds::YFP (PGL290; GenBank AF234315; von Besser et al., 2006) that fully rescues hap2(−) A. thaliana mutants (Wong et al., 2010).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGGS::AtHAP2-V5 was a gift from Benjamin Podbilewicz (Addgene plasmid # 132958 ; http://n2t.net/addgene:132958 ; RRID:Addgene_132958)
  • For your References section:

    Arabidopsis HAP2/GCS1 is a gamete fusion protein homologous to somatic and viral fusogens. Valansi C, Moi D, Leikina E, Matveev E, Grana M, Chernomordik LV, Romero H, Aguilar PS, Podbilewicz B. J Cell Biol. 2017 Mar 6;216(3):571-581. doi: 10.1083/jcb.201610093. Epub 2017 Jan 30. 10.1083/jcb.201610093 PubMed 28137780