pCAGGS::AtHAP2-V5
(Plasmid #132958)

• Purpose: Express AtHAP2 full length protein in mammalian cells
• Depositing Lab: Benjamin Podbilewicz
• Publication: Valansi et al J Cell Biol. 2017 Mar 6;216(3):571-581. doi: 10.1083/jcb.201610093. Epub 2017 Jan 30.

Backbone

• Vector backbone: pCAGGS
• Backbone size w/o insert (bp): 4741
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: AtHAP2
• Alt name: At GCS1
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 2172
• GenBank ID: 826777
• Entrez Gene: GCS1 (a.k.a. AT1G67490, KNF, KNOPF, T1F15.4, T1F15_4, glucosidase 1)
• Entrez Gene: HAP2 (a.k.a. AT4G11720, GCS1, GENERATIVE CELL-SPECIFIC 1, HAPLESS 2, T5C23.150, T5C23_150)
• Tag / Fusion Protein:
  • V5 (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: ClaI (not destroyed)
• 3′ cloning site: XmaI (not destroyed)
• 5′ sequencing primer: GCAACGTGCTGGTTATTGTGCTGTC
• 3′ sequencing primer: TCCCATATGTCCTTCCGAGTGA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The A. thaliana HAP2 plasmids were derived from AtHAP2promoter::HAP2cds::YFP (PGL290; GenBank AF234315; von Besser et al., 2006) that fully rescues hap2(−) A. thaliana mutants (Wong et al., 2010).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry