Skip to main content

1647_pGL4.51 TLV41 SSA-Luc cloning vector_Circular
(Plasmid #132962)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132962 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL4.51
  • Backbone manufacturer
    Promega
  • Total vector size (bp) 6727
  • Modifications to backbone
    Stop sequences between Firefly Luciferase sequence
  • Vector type
    Mammalian Expression, CRISPR, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Firefly Luciferase
  • Species
    Synthetic
  • Mutation
    Stop sequence between luciferase gene
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (destroyed during cloning)
  • 3′ cloning site SbfI (destroyed during cloning)
  • 5′ sequencing primer TTACCGACGCACATATCGAG
  • 3′ sequencing primer TGACTGAATCGGACACAAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    1647_pGL4.51 TLV41 SSA-Luc cloning vector_Circular was a gift from Gang Bao (Addgene plasmid # 132962 ; http://n2t.net/addgene:132962 ; RRID:Addgene_132962)
  • For your References section:

    High-throughput cellular screening of engineered nuclease activity using the single-strand annealing assay and luciferase reporter. Cradick TJ, Antico CJ, Bao G. Methods Mol Biol. 2014;1114:339-52. doi: 10.1007/978-1-62703-761-7_22. 10.1007/978-1-62703-761-7_22 PubMed 24557914