pFE-hCA
(Plasmid
#132999)
-
PurposepFE carrying a human carbonic anhydrase II gene (Uniprot: P00918)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132999 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepFE
- Backbone size w/o insert (bp) 3132
- Total vector size (bp) 3951
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehCAII
-
SpeciesH. sapiens (human)
-
Insert Size (bp)823
-
Entrez GeneCA2 (a.k.a. CA-II, CAC, CAII, Car2, HEL-76, HEL-S-282)
- Promoter tetR
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CCTTTCGTCTTCACCTCGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFE-hCA was a gift from David Savage (Addgene plasmid # 132999 ; http://n2t.net/addgene:132999 ; RRID:Addgene_132999) -
For your References section:
DABs are inorganic carbon pumps found throughout prokaryotic phyla. Desmarais JJ, Flamholz AI, Blikstad C, Dugan EJ, Laughlin TG, Oltrogge LM, Chen AW, Wetmore K, Diamond S, Wang JY, Savage DF. Nat Microbiol. 2019 Aug 12. pii: 10.1038/s41564-019-0520-8. doi: 10.1038/s41564-019-0520-8. 10.1038/s41564-019-0520-8 PubMed 31406332