pFE-baDAB
(Plasmid
#133003)
-
PurposepFE carrying the badabA and badabB genes
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133003 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFE
- Backbone size w/o insert (bp) 3132
- Total vector size (bp) 7289
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namebadabB
-
SpeciesBacillus anthracis str. Sterne
-
Insert Size (bp)1533
-
GenBank IDBAS2959
- Promoter tetR
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CCTTTCGTCTTCACCTCGAG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namevcdabA
-
SpeciesBacillus anthracis str. Sterne
-
Insert Size (bp)2625
-
GenBank IDBAS2958
- Promoter tetR
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer GCGTTCACCGACAAACAACAGA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFE-baDAB was a gift from David Savage (Addgene plasmid # 133003 ; http://n2t.net/addgene:133003 ; RRID:Addgene_133003) -
For your References section:
DABs are inorganic carbon pumps found throughout prokaryotic phyla. Desmarais JJ, Flamholz AI, Blikstad C, Dugan EJ, Laughlin TG, Oltrogge LM, Chen AW, Wetmore K, Diamond S, Wang JY, Savage DF. Nat Microbiol. 2019 Aug 12. pii: 10.1038/s41564-019-0520-8. doi: 10.1038/s41564-019-0520-8. 10.1038/s41564-019-0520-8 PubMed 31406332