pET14b-dabAB2 D353A
(Plasmid
#133016)
-
PurposepET14b carrying the dabA2 gene (Uniprot: D0KWS7) with a D353A mutation fused to a c-terminal strep tag and the dabB2 gene (Uniprot: D0KWS8) with a c-terminal sfGFP V206K fusion and 6xHis tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133016 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET14b
- Backbone size w/o insert (bp) 4607
- Total vector size (bp) 9560
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namedabB2
-
SpeciesHalothiobacillus neapolitanus c2
-
Insert Size (bp)1653
-
GenBank IDWP_012823111.1
- Promoter t7
-
Tags
/ Fusion Proteins
- sfGFP (C terminal on insert)
- 6xHis (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namedabA2
-
SpeciesHalothiobacillus neapolitanus c2
-
Insert Size (bp)2481
-
MutationD353A
-
GenBank IDWP_012823110.1
- Promoter t7
-
Tag
/ Fusion Protein
- StrepII tag (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer Caaaggcacacaccatttacc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET14b-dabAB2 D353A was a gift from David Savage (Addgene plasmid # 133016 ; http://n2t.net/addgene:133016 ; RRID:Addgene_133016) -
For your References section:
DABs are inorganic carbon pumps found throughout prokaryotic phyla. Desmarais JJ, Flamholz AI, Blikstad C, Dugan EJ, Laughlin TG, Oltrogge LM, Chen AW, Wetmore K, Diamond S, Wang JY, Savage DF. Nat Microbiol. 2019 Aug 12. pii: 10.1038/s41564-019-0520-8. doi: 10.1038/s41564-019-0520-8. 10.1038/s41564-019-0520-8 PubMed 31406332