Skip to main content

pFloat.assemble(AB).LC_v1
(Plasmid #133083)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133083 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFloat_v1
  • Backbone manufacturer
    Kacper Rogala
  • Backbone size (bp) 4238
  • Vector type
    Bacterial Expression ; Destination vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGTATAACGTTACTGGTTTCA
  • 3′ sequencing primer GAGTTTTCTCCTTCATTACAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFloat.assemble(AB).LC_v1 was a gift from Kacper Rogala & David Sabatini (Addgene plasmid # 133083 ; http://n2t.net/addgene:133083 ; RRID:Addgene_133083)
  • For your References section:

    Structural basis for the docking of mTORC1 on the lysosomal surface. Rogala KB, Gu X, Kedir JF, Abu-Remaileh M, Bianchi LF, Bottino AMS, Dueholm R, Niehaus A, Overwijn D, Fils AP, Zhou SX, Leary D, Laqtom NN, Brignole EJ, Sabatini DM. Science. 2019 Oct 25;366(6464):468-475. doi: 10.1126/science.aay0166. Epub 2019 Oct 10. 10.1126/science.aay0166 PubMed 31601708