pFloat.assemble(AB).HC_v1
(Plasmid
#133084)
-
Purpose(Empty Backbone) Tier 1 destination vector for assembling gene cassettes intended for expression in bacteria. AB sites. High copy. Version 1.0.
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133084 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFloat_v1
-
Backbone manufacturerKacper Rogala
- Backbone size (bp) 3742
-
Vector typeBacterial Expression ; Destination vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTATAACGTTACTGGTTTCA
- 3′ sequencing primer GAGTTTTCTCCTTCATTACAGA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFloat.assemble(AB).HC_v1 was a gift from Kacper Rogala & David Sabatini (Addgene plasmid # 133084 ; http://n2t.net/addgene:133084 ; RRID:Addgene_133084) -
For your References section:
Structural basis for the docking of mTORC1 on the lysosomal surface. Rogala KB, Gu X, Kedir JF, Abu-Remaileh M, Bianchi LF, Bottino AMS, Dueholm R, Niehaus A, Overwijn D, Fils AP, Zhou SX, Leary D, Laqtom NN, Brignole EJ, Sabatini DM. Science. 2019 Oct 25;366(6464):468-475. doi: 10.1126/science.aay0166. Epub 2019 Oct 10. 10.1126/science.aay0166 PubMed 31601708