Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFloat.assemble(AB).HC_v1
(Plasmid #133084)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 133084 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFloat_v1
  • Backbone manufacturer
    Kacper Rogala
  • Backbone size (bp) 3742
  • Vector type
    Bacterial Expression ; Destination vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGTATAACGTTACTGGTTTCA
  • 3′ sequencing primer GAGTTTTCTCCTTCATTACAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFloat.assemble(AB).HC_v1 was a gift from Kacper Rogala & David Sabatini (Addgene plasmid # 133084 ; http://n2t.net/addgene:133084 ; RRID:Addgene_133084)
  • For your References section:

    Structural basis for the docking of mTORC1 on the lysosomal surface. Rogala KB, Gu X, Kedir JF, Abu-Remaileh M, Bianchi LF, Bottino AMS, Dueholm R, Niehaus A, Overwijn D, Fils AP, Zhou SX, Leary D, Laqtom NN, Brignole EJ, Sabatini DM. Science. 2019 Oct 25;366(6464):468-475. doi: 10.1126/science.aay0166. Epub 2019 Oct 10. 10.1126/science.aay0166 PubMed 31601708