pSHUT4-eYFP
(Plasmid
#133094)
-
PurposeAgrobacterium T-DNA overexpression cassette comprising constitutive TEF-1alpha fused to reporter eYFP. Integrates near beta-tubulin gene in F. solani genome. Replace eYFP w/ XhoI BamHI
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133094 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSHUT3
-
Backbone manufacturerIn-house plasmid
- Total vector size (bp) 10460
-
Modifications to backboneBackbone is U-GOTL modified with URA3 from pYES2(Invitrogen) and CEN-ARS from pRS315 (ATCC 77144)
-
Vector typeFungal expression
-
Selectable markersGentamicin, URA3
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameenhanced yellow flourescent protein
-
Alt nameeYFP
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter TEF-1α
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TTTCCCCCATACCTCCTTTC
- 3′ sequencing primer AAGACCGGCAACAGGATTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAgrobacterium T-DNA cassette taken from p-UGOTL-TEF1α-eYFP (Lukassen et al, Mar Drugs 2015, 13:4331-4343.) holding the eYFP gene from EarleyGate 104 (Earley et al. The Plant Journal 2006, 45(4):616-629.)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSHUT4-eYFP was a gift from Jens Laurids Sørensen (Addgene plasmid # 133094 ; http://n2t.net/addgene:133094 ; RRID:Addgene_133094) -
For your References section:
A new vector system for targeted integration and overexpression of genes in the crop pathogen Fusarium solani. Nielsen MR, Holzwarth AKR, Brew E, Chrapkova N, Kaniki SEK, Kastaniegaard K, Sorensen T, Westphal KR, Wimmer R, Sondergaard TE, Sorensen JL. Fungal Biol Biotechnol. 2019 Dec 11;6:25. doi: 10.1186/s40694-019-0089-2. eCollection 2019. 10.1186/s40694-019-0089-2 PubMed 31890232