Skip to main content

pSHUT4-eYFP
(Plasmid #133094)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133094 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSHUT3
  • Backbone manufacturer
    In-house plasmid
  • Total vector size (bp) 10460
  • Modifications to backbone
    Backbone is U-GOTL modified with URA3 from pYES2(Invitrogen) and CEN-ARS from pRS315 (ATCC 77144)
  • Vector type
    Fungal expression
  • Selectable markers
    Gentamicin, URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    enhanced yellow flourescent protein
  • Alt name
    eYFP
  • Species
    Synthetic
  • Insert Size (bp)
    720
  • Promoter TEF-1α

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TTTCCCCCATACCTCCTTTC
  • 3′ sequencing primer AAGACCGGCAACAGGATTC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Agrobacterium T-DNA cassette taken from p-UGOTL-TEF1α-eYFP (Lukassen et al, Mar Drugs 2015, 13:4331-4343.) holding the eYFP gene from EarleyGate 104 (Earley et al. The Plant Journal 2006, 45(4):616-629.)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSHUT4-eYFP was a gift from Jens Laurids Sørensen (Addgene plasmid # 133094 ; http://n2t.net/addgene:133094 ; RRID:Addgene_133094)
  • For your References section:

    A new vector system for targeted integration and overexpression of genes in the crop pathogen Fusarium solani. Nielsen MR, Holzwarth AKR, Brew E, Chrapkova N, Kaniki SEK, Kastaniegaard K, Sorensen T, Westphal KR, Wimmer R, Sondergaard TE, Sorensen JL. Fungal Biol Biotechnol. 2019 Dec 11;6:25. doi: 10.1186/s40694-019-0089-2. eCollection 2019. 10.1186/s40694-019-0089-2 PubMed 31890232