pPCK
(Plasmid
#133128)
-
Purposea recombinant plasmid, expressing pckA PEP-carboxykinase) gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 133128 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLGZ920
-
Backbone manufacturerPil Kim
- Backbone size w/o insert (bp) 5403
- Total vector size (bp) 7226
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePEP-carboxykinase gene
-
Alt namepckA
-
SpeciesActinobacillus succinogenes
-
Insert Size (bp)1617
- Promoter PEP-carboxykinase promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCAGCAATAGAGGAAACACGGTTTG
- 3′ sequencing primer GGATTTGGTACCGTGCCGGCGGCCTAATAACCTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPCK was a gift from Gregg Beckham (Addgene plasmid # 133128 ; http://n2t.net/addgene:133128 ; RRID:Addgene_133128) -
For your References section:
Metabolic Engineering of Actinobacillus succinogenes Provides Insights into Succinic Acid Biosynthesis. Guarnieri MT, Chou YC, Salvachua D, Mohagheghi A, St John PC, Peterson DJ, Bomble YJ, Beckham GT. Appl Environ Microbiol. 2017 Aug 17;83(17). pii: AEM.00996-17. doi: 10.1128/AEM.00996-17. Print 2017 Sep 1. 10.1128/AEM.00996-17 PubMed 28625987