MOM603
(Plasmid
#133242)
-
Purposeexpresses full-length human KIF1A fused with mScarlet and StrepII tag in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 133242 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAcebac1
- Total vector size (bp) 9087
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namekif1a
-
Alt namekinesin superfamily protein 1A
-
Alt nameSPG30
-
Alt nameATSV
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5323
-
GenBank IDAB210029
-
Entrez GeneKIF1A (a.k.a. ATSV, C2orf20, HSN2C, MRD9, NESCAVS, SPG30, UNC104)
- Promoter polyhedrin promoter
-
Tags
/ Fusion Proteins
- mScarlet (C terminal on insert)
- StrepII tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AAATGATAACCATCTCGC
- 3′ sequencing primer ATTTTATGTTTCAGGTTCAGGGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MOM603 was a gift from Shinsuke Niwa (Addgene plasmid # 133242 ; http://n2t.net/addgene:133242 ; RRID:Addgene_133242) -
For your References section:
Disease-associated mutations hyperactivate KIF1A motility and anterograde axonal transport of synaptic vesicle precursors. Chiba K, Takahashi H, Chen M, Obinata H, Arai S, Hashimoto K, Oda T, McKenney RJ, Niwa S. Proc Natl Acad Sci U S A. 2019 Aug 27. pii: 1905690116. doi: 10.1073/pnas.1905690116. 10.1073/pnas.1905690116 PubMed 31455732