MOM603
(Plasmid #133242)

• Purpose: expresses full-length human KIF1A fused with mScarlet and StrepII tag in insect cells
• Depositing Lab: Shinsuke Niwa
• Publication: Chiba et al Proc Natl Acad Sci U S A. 2019 Aug 27. pii: 1905690116. doi: 10.1073/pnas.1905690116.

Backbone

• Vector backbone: pAcebac1
• Total vector size (bp): 9087
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Gentamicin, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: kif1a
• Alt name: kinesin superfamily protein 1A
• Alt name: SPG30
• Alt name: ATSV
• Species: H. sapiens (human)
• Insert Size (bp): 5323
• GenBank ID: AB210029
• Entrez Gene: KIF1A (a.k.a. ATSV, C2orf20, HSN2C, MRD9, NESCAVS, SPG30, UNC104)
• Promoter: polyhedrin promoter
• Tags / Fusion Proteins:
  • mScarlet (C terminal on insert)
  • StrepII tag (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AAATGATAACCATCTCGC
• 3′ sequencing primer: ATTTTATGTTTCAGGTTCAGGGGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry