Skip to main content

pJFRC7-UAS-NPRR_ANP
(Plasmid #133243)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133243 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJFRC7
  • Backbone size w/o insert (bp) 8100
  • Total vector size (bp) 9960
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rat atrial natriuretic peptide-fused codon-optimized GCaMP6s
  • Species
    R. norvegicus (rat), D. melanogaster (fly)
  • Insert Size (bp)
    1800
  • Promoter hsp70

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aactactgaaatctgccaagaagtaatt
  • 3′ sequencing primer tttgtccaattatgtcacaccacag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene QC NGS analysis identified a sequence discrepancy at nucleotide 7954, resulting in an A201S mutation in the plasmid insert. The depositing lab has indicated that this should not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJFRC7-UAS-NPRR_ANP was a gift from David Anderson (Addgene plasmid # 133243 ; http://n2t.net/addgene:133243 ; RRID:Addgene_133243)
  • For your References section:

    Imaging neuropeptide release at synapses with a genetically engineered reporter. Ding K, Han Y, Seid TW, Buser C, Karigo T, Zhang S, Dickman DK, Anderson DJ. Elife. 2019 Jun 26;8. pii: 46421. doi: 10.7554/eLife.46421. 10.7554/eLife.46421 PubMed 31241464