SHC003BSD-EXOC7
(Plasmid
#133298)
-
PurposeExpresses EXOC7 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133298 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneSHC003
- Backbone size w/o insert (bp) 8347
- Total vector size (bp) 9634
-
Modifications to backboneThe selection marker in mammalian cells was modified as blasticidin, the EGFP reporter sequence was removed. EXOC7 gene with 3XFLAG conjugated was inserted into the vector.
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameExocyst complex component 7
-
Alt nameEXO70
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2056
-
Entrez GeneEXOC7 (a.k.a. 2-5-3p, BLOM4, EX070, EXO70, EXOC1, Exo70p, NEDSEBA, YJL085W)
- Promoter CMV promoter
-
Tag
/ Fusion Protein
- 3XFLAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer cmvFor (CGCAAATGGGCGGTAGGCGTG)
- 3′ sequencing primer SHC03CMVRev (CTTCACCGGCATCTGCATCC)
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SHC003BSD-EXOC7 was a gift from Jingshi Shen (Addgene plasmid # 133298 ; http://n2t.net/addgene:133298 ; RRID:Addgene_133298) -
For your References section:
Inducible Exoc7/Exo70 knockout reveals a critical role of the exocyst in insulin-regulated GLUT4 exocytosis. Wang S, Crisman L, Miller J, Datta I, Gulbranson DR, Tian Y, Yin Q, Yu H, Shen J. J Biol Chem. 2019 Dec 27;294(52):19988-19996. doi: 10.1074/jbc.RA119.010821. Epub 2019 Nov 18. 10.1074/jbc.RA119.010821 PubMed 31740584