SHC003BSD-EXOC7
(Plasmid #133298)

• Purpose: Expresses EXOC7 in mammalian cells
• Depositing Lab: Jingshi Shen
• Publication: Wang et al J Biol Chem. 2019 Dec 27;294(52):19988-19996. doi: 10.1074/jbc.RA119.010821. Epub 2019 Nov 18.

Backbone

• Vector backbone: SHC003
• Backbone size w/o insert (bp): 8347
• Total vector size (bp): 9634
• Modifications to backbone: The selection marker in mammalian cells was modified as blasticidin, the EGFP reporter sequence was removed. EXOC7 gene with 3XFLAG conjugated was inserted into the vector.
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Exocyst complex component 7
• Alt name: EXO70
• Species: H. sapiens (human)
• Insert Size (bp): 2056
• Entrez Gene: EXOC7 (a.k.a. 2-5-3p, BLOM4, EX070, EXO70, EXOC1, Exo70p, NEDSEBA, YJL085W)
• Promoter: CMV promoter
• Tag / Fusion Protein:
  • 3XFLAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: cmvFor (CGCAAATGGGCGGTAGGCGTG)
• 3′ sequencing primer: SHC03CMVRev (CTTCACCGGCATCTGCATCC)

Resource Information

• Supplemental Documents:
  • SHC003BSD-EXOC7.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry