TLCV2-Exoc7-Ex5&10
(Plasmid
#133303)
-
PurposeEGFP reporter sequence was removed from TLCV2 vector and two gRNAs targeting mouse Exoc7 gene were cloned into the modified TLCV2 vector.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133303 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneTLCV2
-
Backbone manufacturerAdam Karpf
- Backbone size w/o insert (bp) 16733
- Total vector size (bp) 14608
-
Modifications to backboneEGFP reporter sequence was removed from TLCV2 (Addgene, #87360). Next, one gRNA targeting the mouse Exoc7 gene was subcloned into the BsmbI site of the modified TLCV2 vector. Meanwhile, the second gRNA targeting mouse Exoc7 was subcloned into the BbsI site of the pmU6-gRNA vector (Addgene, #53187). Next, the expression cassette of the second gRNA, including the mU6 promoter, the gRNA and the gRNA scaffold, was amplified by PCR with KpnI sites introduced at both ends. The PCR product was subcloned into the KpnI site of the modified TLCV2 vector containing the first gRNA.
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameExocyst complex component 7
-
Alt nameExo70
-
gRNA/shRNA sequencemExoc7Ex5 (AGAAGCTGCTGTTTGAGCGA); mExoc7Ex10 (TTCTAGAGCTTTGGCCCCAA)
-
SpeciesM. musculus (mouse)
-
Entrez GeneExoc7 (a.k.a. Exo70, sec70)
- Promoter mU6 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer mU6For (atagatccgacgccgcca)
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TLCV2-Exoc7-Ex5&10 was a gift from Jingshi Shen (Addgene plasmid # 133303 ; http://n2t.net/addgene:133303 ; RRID:Addgene_133303) -
For your References section:
Inducible Exoc7/Exo70 knockout reveals a critical role of the exocyst in insulin-regulated GLUT4 exocytosis. Wang S, Crisman L, Miller J, Datta I, Gulbranson DR, Tian Y, Yin Q, Yu H, Shen J. J Biol Chem. 2019 Dec 27;294(52):19988-19996. doi: 10.1074/jbc.RA119.010821. Epub 2019 Nov 18. 10.1074/jbc.RA119.010821 PubMed 31740584