pUC-GFP-MCC
(Plasmid #133307)

• Purpose: "Burdensome" GFP expressing plasmid carrying microcin-V bacteriocin for plasmid stabilisation
• Depositing Lab: Chris Barnes
• Publication: Fedorec et al iScience. 2019 Apr 26;14:323-334. doi: 10.1016/j.isci.2019.03.019. Epub 2019 Mar 22.

Backbone

• Vector backbone: pSF_UC_OXB20-daGFP
• Backbone manufacturer: Oxford Genetics
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 9521
• Modifications to backbone: original SC101 ori replaced with pUC ori
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: microcin-V bacteriocin cassette
• Alt name: mccV
• Species: E. coli
• Mutation: N112D (please see depositors comments)
• Entrez Gene: cvaC (a.k.a. CR540_RS26765, CR540_28145)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (unknown if destroyed)
• 3′ cloning site: XbaI (unknown if destroyed)
• 5′ sequencing primer: ACTGCTGATCGAGTGTAGCCA
• 3′ sequencing primer: CTGTGAGCTGAAGGTACGCTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Original mccV cassette from:
Gilson, L., Mahanty, H.K. and Kolter, R., 1987. Four plasmid genes are required for colicin V synthesis, export, and immunity. Journal of bacteriology, 169(6), pp.2466-2470.
PMID: 3034857

Depositor confirms N112D mutation in the first insert does not affect function of the plasmid.