Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

GWF303
(Plasmid #133611)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133611 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJZC43
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD95-1-2xPP7, PCP-DNCR2, BFP
  • gRNA/shRNA sequence
    GTACAGCAGAAGCCTTTAGAA

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GWF303 was a gift from Dustin Maly (Addgene plasmid # 133611 ; http://n2t.net/addgene:133611 ; RRID:Addgene_133611)
  • For your References section:

    Multi-input chemical control of protein dimerization for programming graded cellular responses. Foight GW, Wang Z, Wei CT, Jr Greisen P, Warner KM, Cunningham-Bryant D, Park K, Brunette TJ, Sheffler W, Baker D, Maly DJ. Nat Biotechnol. 2019 Sep 9. pii: 10.1038/s41587-019-0242-8. doi: 10.1038/s41587-019-0242-8. 10.1038/s41587-019-0242-8 PubMed 31501561