Skip to main content

pLB(N)CX-FLAG-CH3
(Plasmid #133718)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133718 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLB(N)CX
  • Total vector size (bp) 6907
  • Vector type
    Retroviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EP300
  • Alt name
    SV40 LT binding domain of p300 (CH3)
  • Species
    H. sapiens (human)
  • Mutation
    partial (not complete) p300 fragment, CH3 domain only
  • Entrez Gene
    EP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer pLNXC F - agctcgtttagtgaaccgtcagatcg
  • 3′ sequencing primer pLNCX R - acctacaggtggggtctttcattccc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

HMS clone ID number: HsCD00061640
Please see Supplemental Documents > Depositor Notes for more cloning information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLB(N)CX-FLAG-CH3 was a gift from James A. DeCaprio (Addgene plasmid # 133718 ; http://n2t.net/addgene:133718 ; RRID:Addgene_133718)
  • For your References section:

    Targeting of p300/CREB binding protein coactivators by simian virus 40 is mediated through p53. Borger DR, DeCaprio JA. J Virol. 2006 May . 80(9):4292-303. 10.1128/JVI.80.9.4292-4303.2006 PubMed 16611888