pLB(N)CX-FLAG-CH3 Del33
(Plasmid
#133724)
-
PurposeRetroviral vector with CMV promoter driving mutant form of CH3 domain fragment of human p300 (EP300), with N-terminal FLAG tag.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133724 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLB(N)CX
- Total vector size (bp) 6610
-
Vector typeRetroviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEP300
-
SpeciesH. sapiens (human)
-
Mutationpartial (not complete) p300 fragment, AT and CH3 domains only; deletion in CH3 domain (11 1737-1836), disrupts SC40 LT binding
-
Entrez GeneEP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer pLNXC F - agctcgtttagtgaaccgtcagatcg
- 3′ sequencing primer pLNCX R - acctacaggtggggtctttcattccc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
HMS clone ID number: HsCD00061646
Please see Supplemental Documents > Depositor Notes for more cloning information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLB(N)CX-FLAG-CH3 Del33 was a gift from James A. DeCaprio (Addgene plasmid # 133724 ; http://n2t.net/addgene:133724 ; RRID:Addgene_133724) -
For your References section:
Targeting of p300/CREB binding protein coactivators by simian virus 40 is mediated through p53. Borger DR, DeCaprio JA. J Virol. 2006 May . 80(9):4292-303. 10.1128/JVI.80.9.4292-4303.2006 PubMed 16611888