pLB(N)CX AT-CH3-FLAG-HA WY
(Plasmid
#133725)
-
PurposeRetroviral vector with CMV promoter driving mutant form of acetyltransferase and CH3 domains fragment of human p300 (EP300) (WY1466-1467AS in AT domain).
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133725 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLB(N)CX
- Backbone size w/o insert (bp) 6229
- Total vector size (bp) 8491
-
Vector typeRetroviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEP300
-
Alt namep300 acetyltransferase CH3 fragment
-
SpeciesH. sapiens (human)
-
Mutationpartial (not complete) p300 fragment, AT and CH3 domains only; W1466A, Y1467S
-
Entrez GeneEP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
-
Tags
/ Fusion Proteins
- Flag (C terminal on insert)
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site HpaI (not destroyed)
- 5′ sequencing primer pLNXC F - agctcgtttagtgaaccgtcagatcg
- 3′ sequencing primer pLNCX R - acctacaggtggggtctttcattccc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
HMS clone ID number: HsCD00061647.
Please see Supplemental Documents > Depositors Notes for more cloning information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLB(N)CX AT-CH3-FLAG-HA WY was a gift from James A. DeCaprio (Addgene plasmid # 133725 ; http://n2t.net/addgene:133725 ; RRID:Addgene_133725) -
For your References section:
Targeting of p300/CREB binding protein coactivators by simian virus 40 is mediated through p53. Borger DR, DeCaprio JA. J Virol. 2006 May . 80(9):4292-303. 10.1128/JVI.80.9.4292-4303.2006 PubMed 16611888