Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLB(N)CX AT-CH3-FLAG-HA WY
(Plasmid #133725)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 133725 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLB(N)CX
  • Backbone size w/o insert (bp) 6229
  • Total vector size (bp) 8491
  • Vector type
    Retroviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EP300
  • Alt name
    p300 acetyltransferase CH3 fragment
  • Species
    H. sapiens (human)
  • Mutation
    partial (not complete) p300 fragment, AT and CH3 domains only; W1466A, Y1467S
  • Entrez Gene
    EP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
  • Tags / Fusion Proteins
    • Flag (C terminal on insert)
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer pLNXC F - agctcgtttagtgaaccgtcagatcg
  • 3′ sequencing primer pLNCX R - acctacaggtggggtctttcattccc
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

HMS clone ID number: HsCD00061647.
Please see Supplemental Documents > Depositors Notes for more cloning information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLB(N)CX AT-CH3-FLAG-HA WY was a gift from James A. DeCaprio (Addgene plasmid # 133725 ; http://n2t.net/addgene:133725 ; RRID:Addgene_133725)
  • For your References section:

    Targeting of p300/CREB binding protein coactivators by simian virus 40 is mediated through p53. Borger DR, DeCaprio JA. J Virol. 2006 May . 80(9):4292-303. 10.1128/JVI.80.9.4292-4303.2006 PubMed 16611888