PWPXLD-EGFR-P667A
(Plasmid
#133750)
-
PurposeEGFR with mutation at proline 667 converted to alanine and tagged with HA cloned into PWPXLD plasmid
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133750 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePWPXLD
- Backbone size w/o insert (bp) 10455
- Total vector size (bp) 14088
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMutant P667A EGFR-HA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3633
-
Mutationproline 667 converted to alanine (Please see depositor comments below)
-
GenBank IDNM_005228
-
Entrez GeneEGFR (a.k.a. ERBB, ERBB1, ERRP, HER1, NISBD2, NNCIS, PIG61, mENA)
- Promoter EF1-alpha
-
Tag
/ Fusion Protein
- HA tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MLU1 (unknown if destroyed)
- 3′ cloning site SPE1 (unknown if destroyed)
- 5′ sequencing primer CAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer GCGTAAAAGGAGCAACATAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The mutation in this human EGFR cDNA corresponds to the conversion of proline 667 to alanine described in Cheng He et al., JBC, 2002. In this larger isoform of human EGFR the proline is located at 691. The site of the mutation is 685-RELVEP-691.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PWPXLD-EGFR-P667A was a gift from Chay Kuo (Addgene plasmid # 133750 ; http://n2t.net/addgene:133750 ; RRID:Addgene_133750) -
For your References section:
EGFR Signaling Termination via Numb Trafficking in Ependymal Progenitors Controls Postnatal Neurogenic Niche Differentiation. Abdi K, Neves G, Pyun J, Kiziltug E, Ahrens A, Kuo CT. Cell Rep. 2019 Aug 20;28(8):2012-2022.e4. doi: 10.1016/j.celrep.2019.07.056. 10.1016/j.celrep.2019.07.056 PubMed 31433979