PWPXLD-EGFR-P667A
(Plasmid #133750)

• Purpose: EGFR with mutation at proline 667 converted to alanine and tagged with HA cloned into PWPXLD plasmid
• Depositing Lab: Chay Kuo
• Publication: Abdi et al Cell Rep. 2019 Aug 20;28(8):2012-2022.e4. doi: 10.1016/j.celrep.2019.07.056.

Backbone

• Vector backbone: PWPXLD
• Backbone size w/o insert (bp): 10455
• Total vector size (bp): 14088
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Mutant P667A EGFR-HA
• Species: H. sapiens (human)
• Insert Size (bp): 3633
• Mutation: proline 667 converted to alanine (Please see depositor comments below)
• GenBank ID: NM_005228
• Entrez Gene: EGFR (a.k.a. ERBB, ERBB1, ERRP, HER1, NISBD2, PIG61, mENA)
• Promoter: EF1-alpha
• Tag / Fusion Protein:
  • HA tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: MLU1 (unknown if destroyed)
• 3′ cloning site: SPE1 (unknown if destroyed)
• 5′ sequencing primer: CAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: GCGTAAAAGGAGCAACATAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The mutation in this human EGFR cDNA corresponds to the conversion of proline 667 to alanine described in Cheng He et al., JBC, 2002. In this larger isoform of human EGFR the proline is located at 691. The site of the mutation is 685-RELVEP-691.