Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

PWPXLD-EGFR-P667A
(Plasmid #133750)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 133750 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PWPXLD
  • Backbone size w/o insert (bp) 10455
  • Total vector size (bp) 14088
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Mutant P667A EGFR-HA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3633
  • Mutation
    proline 667 converted to alanine (Please see depositor comments below)
  • GenBank ID
    NM_005228
  • Entrez Gene
    EGFR (a.k.a. ERBB, ERBB1, ERRP, HER1, NISBD2, PIG61, mENA)
  • Promoter EF1-alpha
  • Tag / Fusion Protein
    • HA tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MLU1 (unknown if destroyed)
  • 3′ cloning site SPE1 (unknown if destroyed)
  • 5′ sequencing primer CAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer GCGTAAAAGGAGCAACATAG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The mutation in this human EGFR cDNA corresponds to the conversion of proline 667 to alanine described in Cheng He et al., JBC, 2002. In this larger isoform of human EGFR the proline is located at 691. The site of the mutation is 685-RELVEP-691.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PWPXLD-EGFR-P667A was a gift from Chay Kuo (Addgene plasmid # 133750 ; http://n2t.net/addgene:133750 ; RRID:Addgene_133750)
  • For your References section:

    EGFR Signaling Termination via Numb Trafficking in Ependymal Progenitors Controls Postnatal Neurogenic Niche Differentiation. Abdi K, Neves G, Pyun J, Kiziltug E, Ahrens A, Kuo CT. Cell Rep. 2019 Aug 20;28(8):2012-2022.e4. doi: 10.1016/j.celrep.2019.07.056. 10.1016/j.celrep.2019.07.056 PubMed 31433979