pFudioFRTPSD-95TealW
(Plasmid
#134299)
-
PurposeExpresses PSD95 fused to Teal fluorescent protein upon coexpression with the recombinase flippase (Flp)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134299 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFUW
- Backbone size w/o insert (bp) 9452
- Total vector size (bp) 12389
-
Modifications to backboneInsert is inverted with respect to the promoter and is flanked by incompatible FRT sites (FRT1, FRT5).
-
Vector typeMammalian Expression, Lentiviral ; Flp/FRT
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePSD-95-Teal
-
Alt nameSAP-90, DLG4
-
SpeciesM. musculus (mouse), R. norvegicus (rat)
-
Insert Size (bp)2937
-
Entrez GeneDlg4 (a.k.a. Dlgh4, PSD95, Sap90)
- Promoter UbC
-
Tag
/ Fusion Protein
- Teal (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe1 (not destroyed)
- 3′ cloning site Mlu1 (destroyed during cloning)
- 5′ sequencing primer GTTGGCGAGTGTGTTTTGTG
- 3′ sequencing primer CATTAAAGCAGCGTATCCAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFudioFRTPSD-95TealW was a gift from Elly Nedivi (Addgene plasmid # 134299 ; http://n2t.net/addgene:134299 ; RRID:Addgene_134299) -
For your References section:
CPG15/Neuritin Mimics Experience in Selecting Excitatory Synapses for Stabilization by Facilitating PSD95 Recruitment. Subramanian J, Michel K, Benoit M, Nedivi E. Cell Rep. 2019 Aug 6;28(6):1584-1595.e5. doi: 10.1016/j.celrep.2019.07.012. 10.1016/j.celrep.2019.07.012 PubMed 31390571