Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

S3_001_026_096
(Plasmid #134402)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 134402 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pYTK096
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    mCherry
  • Insert Size (bp)
    711
  • Mutation
    none
  • Promoter pGPM1
  • Tag / Fusion Protein
    • none

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer CTGAACTGGCCGATAATTGCAGACG
  • 3′ sequencing primer GGTTCGTAACATCTCTGTAACTGCT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    NLS_FdeR-N
  • Insert Size (bp)
    927
  • Promoter pTDH3

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer CTGAACTGGCCGATAATTGCAGACG
  • 3′ sequencing primer GGTTCGTAACATCTCTGTAACTGCT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    S3_001_026_096 was a gift from Mattheos Koffas (Addgene plasmid # 134402 ; http://n2t.net/addgene:134402 ; RRID:Addgene_134402)
  • For your References section:

    Design and Characterization of Biosensors for the Screening of Modular Assembled Naringenin Biosynthetic Library in Saccharomyces cerevisiae. Wang R, Cress BF, Yang Z, Hordines JC 3rd, Zhao S, Jung GY, Wang Z, Koffas MAG. ACS Synth Biol. 2019 Sep 20;8(9):2121-2130. doi: 10.1021/acssynbio.9b00212. Epub 2019 Aug 28. 10.1021/acssynbio.9b00212 PubMed 31433622