S3_005_026_096
(Plasmid
#134408)
-
PurposepYTK096-pRPL18B_FdeR-N_2NLS_tPGK1-pGPM1-fdeO_mcherry_tTDH1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134408 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepYTK096
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namemCherry
-
Insert Size (bp)711
-
Mutationnone
- Promoter pGPM1
-
Tag
/ Fusion Protein
- none
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CTGAACTGGCCGATAATTGCAGACG
- 3′ sequencing primer GGTTCGTAACATCTCTGTAACTGCT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameFdeR-N_2xNLS
-
Insert Size (bp)948
-
Mutationnone
- Promoter pRPL18B
-
Tag
/ Fusion Protein
- none
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer CTGAACTGGCCGATAATTGCAGACG
- 3′ sequencing primer GGTTCGTAACATCTCTGTAACTGCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
S3_005_026_096 was a gift from Mattheos Koffas (Addgene plasmid # 134408 ; http://n2t.net/addgene:134408 ; RRID:Addgene_134408) -
For your References section:
Design and Characterization of Biosensors for the Screening of Modular Assembled Naringenin Biosynthetic Library in Saccharomyces cerevisiae. Wang R, Cress BF, Yang Z, Hordines JC 3rd, Zhao S, Jung GY, Wang Z, Koffas MAG. ACS Synth Biol. 2019 Sep 20;8(9):2121-2130. doi: 10.1021/acssynbio.9b00212. Epub 2019 Aug 28. 10.1021/acssynbio.9b00212 PubMed 31433622