-
PurposeLentiviral plasmid expressing SHOC2 with N-term FKBP12(F36V) tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134522 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLEX_305-N-dTAG
- Backbone size w/o insert (bp) 9621
- Total vector size (bp) 11367
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSHOC2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1746
-
MutationSilent mutations made at wobble base position at nucleotides 594, 600, 717, and 723 to prevent gRNA targeting
-
GenBank IDNM_007373.3
-
Entrez GeneSHOC2 (a.k.a. NSLH1, SIAA0862, SOC2, SUR8)
- Promoter hPGK
-
Tag
/ Fusion Protein
- FKBP12F36V-2xHA (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TGTTCCGCATTCTGCAAGCCTC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLEX305_FKBP12F36V-SHOC2 was a gift from Andrew Aguirre (Addgene plasmid # 134522 ; http://n2t.net/addgene:134522 ; RRID:Addgene_134522) -
For your References section:
Synthetic Lethal Interaction of SHOC2 Depletion with MEK Inhibition in RAS-Driven Cancers. Sulahian R, Kwon JJ, Walsh KH, Pailler E, Bosse TL, Thaker M, Almanza D, Dempster JM, Pan J, Piccioni F, Dumont N, Gonzalez A, Rennhack J, Nabet B, Bachman JA, Goodale A, Lee Y, Bagul M, Liao R, Navarro A, Yuan TL, Ng RWS, Raghavan S, Gray NS, Tsherniak A, Vazquez F, Root DE, Firestone AJ, Settleman J, Hahn WC, Aguirre AJ. Cell Rep. 2019 Oct 1;29(1):118-134.e8. doi: 10.1016/j.celrep.2019.08.090. 10.1016/j.celrep.2019.08.090 PubMed 31577942