VPR_dCas9
(Plasmid
#134601)
-
PurposeExpress CHO codon-optimized dCas9 fused to VPR for CRISPR activation. 2A linked ZsGreen1 marker
-
Depositing Lab
-
Depositing OrganizationDanmarks Tekniske Universitet
Located in Denmark -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134601 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 134601-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 134601-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepJ204
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 10240
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVPR-dCas9-2A-ZsGreen-DR
-
SpeciesSynthetic
-
Insert Size (bp)7449
- Promoter CMV
-
Tags
/ Fusion Proteins
- VPR (N terminal on insert)
- ZsGreen1-DR (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AGTCGGTGTGTTGACATTGATTATTGACTA
- 3′ sequencing primer ACGCAAGTCCATAGAGCCCACCGCATCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byVPR was cloned from Addgene plasmid # 68496
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 134601-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 134601-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VPR_dCas9 was a gift from Lasse Ebdrup Pedersen (Addgene plasmid # 134601 ; http://n2t.net/addgene:134601 ; RRID:Addgene_134601) -
For your References section:
Awakening dormant glycosyltransferases in CHO cells with CRISPRa. Karottki KJC, Hefzi H, Xiong K, Shamie I, Hansen AH, Li S, Pedersen LE, Li S, Lee JS, Lee GM, Kildegaard HF, Lewis NE. Biotechnol Bioeng. 2020 Feb;117(2):593-598. doi: 10.1002/bit.27199. Epub 2019 Nov 12. 10.1002/bit.27199 PubMed 31631317