pRSFDuet1-sgRNA(siteA)
(Plasmid #154831)

• Purpose: sgRNA for CRISPR/Cas9-mediated targeted integration into genomic site A in CHO cells
• Depositing Lab: Lise Marie Grav
• Publication: Sergeeva et al ACS Synth Biol. 2020 Aug 24. doi: 10.1021/acssynbio.0c00322.

Backbone

• Vector backbone: pRSFDuet1
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 3801
• Modifications to backbone: Amplified for USER cloning
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: sgRNA(siteA)
• gRNA/shRNA sequence: GACATAGTAACCCCAAAGAG
• Promoter: U6

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: unknown

Resource Information

• Supplemental Documents:
  • pl0458_cled.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This is a sgRNA plasmid for CRISPR/Cas9-mediated targeted integration in Chinese hamster ovary (CHO) cells. The target site A is located on chromosome 2, in intron 2 of Polk in CHO genome.

The genomic site A was initially described in:
Pristovšek N et al., 2019 "Systematic Evaluation of Site-Specific Recombinant Gene Expression for Programmable Mammalian Cell Engineering". DOI: 10.1021/acssynbio.8b00453

Protocol for CRISPR/Cas9-mediated targeted integration in CHO cells:
Sergeeva D et al. 2019 "CRISPR/Cas9 as a Genome Editing Tool for Targeted Gene Integration in CHO Cells". DOI: 10.1007/978-1-4939-9170-9_13

The plasmid was assembled by USER cloning.