Skip to main content
Addgene
Open Menu

pRSFDuet1-sgRNA(siteA)
(Plasmid #154831)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154831 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 154831-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 154831-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pRSFDuet1
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 3801
  • Modifications to backbone
    Amplified for USER cloning
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA(siteA)
  • gRNA/shRNA sequence
    GACATAGTAACCCCAAAGAG
  • Promoter U6

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This is a sgRNA plasmid for CRISPR/Cas9-mediated targeted integration in Chinese hamster ovary (CHO) cells. The target site A is located on chromosome 2, in intron 2 of Polk in CHO genome.

The genomic site A was initially described in:
Pristovšek N et al., 2019 "Systematic Evaluation of Site-Specific Recombinant Gene Expression for Programmable Mammalian Cell Engineering". DOI: 10.1021/acssynbio.8b00453

Protocol for CRISPR/Cas9-mediated targeted integration in CHO cells:
Sergeeva D et al. 2019 "CRISPR/Cas9 as a Genome Editing Tool for Targeted Gene Integration in CHO Cells". DOI: 10.1007/978-1-4939-9170-9_13

The plasmid was assembled by USER cloning.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSFDuet1-sgRNA(siteA) was a gift from Lise Marie Grav (Addgene plasmid # 154831 ; http://n2t.net/addgene:154831 ; RRID:Addgene_154831)

  • For your References section:

    Multi-copy targeted integration for accelerated development of high-producing CHO cells. Sergeeva D, Lee GM, Nielsen LK, Grav LM. ACS Synth Biol. 2020 Aug 24. doi: 10.1021/acssynbio.0c00322. 10.1021/acssynbio.0c00322 PubMed 32835482
Related items:
Commonly requested with: