Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLJM1-FLAG-GFP-Tmem192
(Plasmid #134630)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 134630 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLJM1
  • Backbone size w/o insert (bp) 8133
  • Total vector size (bp) 8946
  • Modifications to backbone
    The original EGFP was removed, and FLAG-GFP was inserted at AgeI and Sall sites, followed by TMEM192 at Sall and EcoRI sites into the pLJM1 backbone.
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TMEM192
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    813
  • Entrez Gene
    TMEM192
  • Tags / Fusion Proteins
    • FLAG (N terminal on backbone)
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sall (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GCAAATGGGCGGTAGGCG
  • 3′ sequencing primer CTTTAGTTTGTATGTCTGTTGC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLJM1-FLAG-GFP-Tmem192 was a gift from Roberto Zoncu (Addgene plasmid # 134630 ; http://n2t.net/addgene:134630 ; RRID:Addgene_134630)
  • For your References section:

    ER-lysosome contacts enable cholesterol sensing by mTORC1 and drive aberrant growth signalling in Niemann-Pick type C. Lim CY, Davis OB, Shin HR, Zhang J, Berdan CA, Jiang X, Counihan JL, Ory DS, Nomura DK, Zoncu R. Nat Cell Biol. 2019 Oct;21(10):1206-1218. doi: 10.1038/s41556-019-0391-5. Epub 2019 Sep 23. 10.1038/s41556-019-0391-5 PubMed 31548609