pLenti CMV Puro DHFR.cHSF1
(Plasmid
#134739)
-
PurposeLentiviral expression vector for constitutively active HSF1 fused to DHFR destabilized domain
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134739 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti CMV Puro Dest (w118-1)
-
Backbone manufacturerEric Campeau, Paul Kaufman
- Backbone size w/o insert (bp) 8022
- Total vector size (bp) 10065
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDHFR.cHSF1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2043
-
MutationDeletion of amino acids 186-202
-
GenBank IDNM_005526.4
-
Entrez GeneHSF1 (a.k.a. HSTF1)
- Promoter CMV
-
Tag
/ Fusion Protein
- DHFR (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti CMV Puro DHFR.cHSF1 was a gift from Matthew D. Shoulders (Addgene plasmid # 134739 ; http://n2t.net/addgene:134739 ; RRID:Addgene_134739) -
For your References section:
Host proteostasis modulates influenza evolution. Phillips AM, Gonzalez LO, Nekongo EE, Ponomarenko AI, McHugh SM, Butty VL, Levine SS, Lin YS, Mirny LA, Shoulders MD. Elife. 2017 Sep 26;6. doi: 10.7554/eLife.28652. 10.7554/eLife.28652 PubMed 28949290