Skip to main content
Addgene

pQXCINeo-LOX-BC
(Plasmid #134762)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134762 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pQCXIN
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LOX
  • Species
    H. sapiens (human)
  • Mutation
    R158Q relative to NP_002308.2
  • Entrez Gene
    LOX (a.k.a. AAT10)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer ACGCCATCCACGCTGTTTTGACCT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    cDNA from cancer cell line

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

(22pb before ATG and +46pb after STOP codon )5'-CTTAATTAACggATCCggTCAATCTggCAAAAgg-3' (5-prime-cloning primer); 5'-ggggggggCggAATTCAgAACACCAggCACTgAT-3' (3-prime-cloning primer)

Addgene NGS detected a R158Q mutation in the LOX translation compared to NP_002308.2. The depositing laboratory confirmed that this mutation does not adversely affect plasmid function

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQXCINeo-LOX-BC was a gift from Philippe Clezardin & Martine Croset (Addgene plasmid # 134762 ; http://n2t.net/addgene:134762 ; RRID:Addgene_134762)