pQXCINeo-LOXL2-BC
(Plasmid
#134763)
-
Purposea retroviral vector to express lysyl oxidaseL2
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134763 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepQCXIN
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLOXL2
-
Insert Size (bp)2325
-
Entrez GeneLOXL2 (a.k.a. LOR, LOR2, WS9-14)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ACGCCATCCACGCTGTTTTGACCT
- 3′ sequencing primer AAGCGGCTTCGGCCAGTAACGTTA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycDNA from cancer cell line
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
5prime cloning site, 5'-CTTAATTAACggATCCAAgACAgggATggAgAggCCT-3';3' prime cloning site 5'-ggggggggCggAATTCACgCAggCTTCTTTACTgCgg-3'
1 unique BamH1 and EcoR1 site inside the insert
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQXCINeo-LOXL2-BC was a gift from Philippe Clezardin & Martine Croset (Addgene plasmid # 134763 ; http://n2t.net/addgene:134763 ; RRID:Addgene_134763)