Skip to main content

pQXCINeo-LOXL2-BC
(Plasmid #134763)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134763 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pQCXIN
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LOXL2
  • Insert Size (bp)
    2325
  • Entrez Gene
    LOXL2 (a.k.a. LOR, LOR2, WS9-14)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ACGCCATCCACGCTGTTTTGACCT
  • 3′ sequencing primer AAGCGGCTTCGGCCAGTAACGTTA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    cDNA from cancer cell line
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5prime cloning site, 5'-CTTAATTAACggATCCAAgACAgggATggAgAggCCT-3';3' prime cloning site 5'-ggggggggCggAATTCACgCAggCTTCTTTACTgCgg-3'

1 unique BamH1 and EcoR1 site inside the insert

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQXCINeo-LOXL2-BC was a gift from Philippe Clezardin & Martine Croset (Addgene plasmid # 134763 ; http://n2t.net/addgene:134763 ; RRID:Addgene_134763)