SMT101
(Plasmid
#134815)
-
PurposeDual expression of DHFR and TYMS, in vivo assays
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134815 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepACYC-Duet
-
Backbone manufacturerNovagen (EMD Millipore)
- Backbone size w/o insert (bp) 4008
- Total vector size (bp) 5180
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameDihydrofolate reductase
-
Alt namefolA
-
SpeciesEscherichia coli
-
Insert Size (bp)480
-
MutationSilent mutations to eliminate internal restriction sites: S49, L62, S64, A81, I82, G97, K109, L110.
-
GenBank IDBAB96616.1
- Promoter T7
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (destroyed during cloning)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GGATCTCGACGCTCTCCCTT
- 3′ sequencing primer GATTATGCGGCCGTGTACAA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameThymidylate synthase
-
Alt namethyA
-
SpeciesEscherichia coli
-
Insert Size (bp)807
-
GenBank IDBAE76896.1
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TTGTACACGGCCGCATAATC
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDerived from Addgene plasmid 91226.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Derived from Addgene plasmid 91226.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SMT101 was a gift from Tanja Kortemme (Addgene plasmid # 134815 ; http://n2t.net/addgene:134815 ; RRID:Addgene_134815) -
For your References section:
Altered expression of a quality control protease in E. coli reshapes the in vivo mutational landscape of a model enzyme. Thompson S, Zhang Y, Ingle C, Reynolds KA, Kortemme T. eLife. 2020 Jul 23;9. pii: 53476. doi: 10.7554/eLife.53476. 10.7554/eLife.53476 PubMed 32701056