Skip to main content
Addgene

SMT201
(Plasmid #134816)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134816 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pACYC-Duet
  • Backbone manufacturer
    Novagen (EMD Millipore)
  • Backbone size w/o insert (bp) 4008
  • Total vector size (bp) 5180
  • Modifications to backbone
    T7 promoter has been replace with a TET promoter.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Dihydrofolate reductase
  • Alt name
    folA
  • Species
    Escherichia coli
  • Insert Size (bp)
    480
  • Mutation
    Silent mutations to eliminate internal restriction sites: S49, L62, S64, A81, I82, G97, K109, L110.
  • GenBank ID
    BAB96616.1
  • Promoter T7

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (destroyed during cloning)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GGATCTCGACGCTCTCCCTT
  • 3′ sequencing primer GATTATGCGGCCGTGTACAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Thymidylate synthase
  • Alt name
    thyA
  • Species
    Escherichia coli
  • Insert Size (bp)
    807
  • GenBank ID
    BAE76896.1
  • Promoter TET

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TTGTACACGGCCGCATAATC
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Modified from plasmids received from the laboratory of Professor Stephen Benkovic (Penn State University).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SMT201 was a gift from Tanja Kortemme (Addgene plasmid # 134816 ; http://n2t.net/addgene:134816 ; RRID:Addgene_134816)
  • For your References section:

    Altered expression of a quality control protease in E. coli reshapes the in vivo mutational landscape of a model enzyme. Thompson S, Zhang Y, Ingle C, Reynolds KA, Kortemme T. eLife. 2020 Jul 23;9. pii: 53476. doi: 10.7554/eLife.53476. 10.7554/eLife.53476 PubMed 32701056