SMT215
(Plasmid
#134818)
-
PurposeSMT205 with DHFR-FLAG-tag, western blot
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134818 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepACYC-Duet
-
Backbone manufacturerNovagen (EMD Millipore)
- Backbone size w/o insert (bp) 4008
- Total vector size (bp) 5180
-
Modifications to backboneT7 promoter has been replace with a TET promoter.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameDihydrofolate reductase
-
Alt namefolA
-
SpeciesEscherichia coli
-
Insert Size (bp)522
-
MutationSilent mutations to eliminate internal restriction sites: S49, L62, S64, A81, I82, G97, K109, L110.
-
GenBank IDBAB96616.1
- Promoter T7
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (unknown if destroyed)
- 3′ cloning site SalI (unknown if destroyed)
- 5′ sequencing primer GGATCTCGACGCTCTCCCTT
- 3′ sequencing primer GATTATGCGGCCGTGTACAA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameThymidylate synthase
-
Alt namethyA
-
SpeciesEscherichia coli
-
Insert Size (bp)807
-
GenBank IDBAE76896.1
- Promoter TET
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TTGTACACGGCCGCATAATC
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byModified from plasmids received from the laboratory of Professor Stephen Benkovic (Penn State University).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SMT215 was a gift from Tanja Kortemme (Addgene plasmid # 134818 ; http://n2t.net/addgene:134818 ; RRID:Addgene_134818) -
For your References section:
Altered expression of a quality control protease in E. coli reshapes the in vivo mutational landscape of a model enzyme. Thompson S, Zhang Y, Ingle C, Reynolds KA, Kortemme T. eLife. 2020 Jul 23;9. pii: 53476. doi: 10.7554/eLife.53476. 10.7554/eLife.53476 PubMed 32701056