pFB1_hMSH2_G674A
(Plasmid
#134874)
-
PurposeExpression human MSH2 G674 mutant protein using baculovirus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134874 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFastBac 1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4776
- Total vector size (bp) 7502
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman MSH2_G674A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2805
-
MutationChanged Glycine to Alanine at aa#674
-
GenBank IDNM_000251
-
Entrez GeneMSH2 (a.k.a. COCA1, FCC1, HNPCC, HNPCC1, LCFS2, LYNCH1, MMRCS2, MSH-2, hMSH2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH I (not destroyed)
- 3′ cloning site Xho I (not destroyed)
- 5′ sequencing primer GAATATTAATAGATCATGG
- 3′ sequencing primer GCTGCAATAAACAAGTTAACAAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFB1_hMSH2_G674A was a gift from Peggy Hsieh (Addgene plasmid # 134874 ; http://n2t.net/addgene:134874 ; RRID:Addgene_134874) -
For your References section:
In vitro studies of DNA mismatch repair proteins. Geng H, Du C, Chen S, Salerno V, Manfredi C, Hsieh P. Anal Biochem. 2011 Jun 15;413(2):179-84. doi: 10.1016/j.ab.2011.02.017. Epub 2011 Feb 15. 10.1016/j.ab.2011.02.017 PubMed 21329650