Skip to main content

pFB1_hMSH2_G674A
(Plasmid #134874)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134874 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFastBac 1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4776
  • Total vector size (bp) 7502
  • Vector type
    Insect Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human MSH2_G674A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2805
  • Mutation
    Changed Glycine to Alanine at aa#674
  • GenBank ID
    NM_000251
  • Entrez Gene
    MSH2 (a.k.a. COCA1, FCC1, HNPCC, HNPCC1, LCFS2, LYNCH1, MMRCS2, MSH-2, hMSH2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH I (not destroyed)
  • 3′ cloning site Xho I (not destroyed)
  • 5′ sequencing primer GAATATTAATAGATCATGG
  • 3′ sequencing primer GCTGCAATAAACAAGTTAACAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFB1_hMSH2_G674A was a gift from Peggy Hsieh (Addgene plasmid # 134874 ; http://n2t.net/addgene:134874 ; RRID:Addgene_134874)
  • For your References section:

    In vitro studies of DNA mismatch repair proteins. Geng H, Du C, Chen S, Salerno V, Manfredi C, Hsieh P. Anal Biochem. 2011 Jun 15;413(2):179-84. doi: 10.1016/j.ab.2011.02.017. Epub 2011 Feb 15. 10.1016/j.ab.2011.02.017 PubMed 21329650