Skip to main content

pUC19-Mu-switch-R-loop
(Plasmid #134899)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134899 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 2686
  • Total vector size (bp) 3070
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mouse IgH switch repeat region
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    435
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GTGTGAAATTGTTATCCGCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC19-Mu-switch-R-loop was a gift from Andrew Deans (Addgene plasmid # 134899 ; http://n2t.net/addgene:134899 ; RRID:Addgene_134899)
  • For your References section:

    Branchpoint translocation by fork remodelers as a general mechanism of R-loop removal. Hodson C, van Twest S, Dylewska M, O'Rourke JJ, Tan W, Murphy VJ, Walia M, Abbouche L, Nieminuszczy J, Dunn E, Bythell-Douglas R, Heierhorst J, Niedzwiedz W, Deans AJ. Cell Rep. 2022 Dec 6;41(10):111749. doi: 10.1016/j.celrep.2022.111749. 10.1016/j.celrep.2022.111749 PubMed 36476850