pUC19-mAirn-R-loop
(Plasmid
#134900)
-
PurposeGeneration and purification of R-loops for in vitro biochemistry
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134900 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2686
- Total vector size (bp) 3066
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemAirn promoter
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)274
-
Entrez GeneAirn (a.k.a. 2810051F02Rik, 2810434M15Rik, Air, B930018I07Rik, D17Ertd663e, IGF2RAS)
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GTGTGAAATTGTTATCCGCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC19-mAirn-R-loop was a gift from Andrew Deans (Addgene plasmid # 134900 ; http://n2t.net/addgene:134900 ; RRID:Addgene_134900) -
For your References section:
Branchpoint translocation by fork remodelers as a general mechanism of R-loop removal. Hodson C, van Twest S, Dylewska M, O'Rourke JJ, Tan W, Murphy VJ, Walia M, Abbouche L, Nieminuszczy J, Dunn E, Bythell-Douglas R, Heierhorst J, Niedzwiedz W, Deans AJ. Cell Rep. 2022 Dec 6;41(10):111749. doi: 10.1016/j.celrep.2022.111749. 10.1016/j.celrep.2022.111749 PubMed 36476850