Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mcherry-Myo 9b R1695M
(Plasmid #134958)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 134958 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pmcherry-C1 (modified)
  • Backbone manufacturer
    Clontech (modified)
  • Backbone size w/o insert (bp) 4652
  • Total vector size (bp) 11501
  • Modifications to backbone
    pmcherry-C1 (Clontech), NT 597-612 and NT 1321-1329 are missing (no Eco 47 III, no Age I, no BspE I site).
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Myo 9b (rat) with 3' UTR. GAP minus mutant R1695M
  • Alt name
    Myr 5 R1695M
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    6849
  • Entrez Gene
    Myo9b
  • Promoter CMV IE
  • Tag / Fusion Protein
    • mcherry (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho I (not destroyed)
  • 3′ cloning site Sma I (destroyed during cloning)
  • 5′ sequencing primer mcherry-F CCCCGTAATGCAGAAGAAGA
  • 3′ sequencing primer SV40pA-R GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: plasmid contains a T721I mutation in Myo9b. This mutation is not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mcherry-Myo 9b R1695M was a gift from Martin Bähler (Addgene plasmid # 134958 ; http://n2t.net/addgene:134958 ; RRID:Addgene_134958)
  • For your References section:

    Local Myo9b RhoGAP activity regulates cell motility. Hemkemeyer SA, Vollmer V, Schwarz V, Lohmann B, Honnert U, Taha M, Schnittler HJ, Bahler M. J Biol Chem. 2021 Jan-Jun;296:100136. doi: 10.1074/jbc.RA120.013623. Epub 2020 Dec 6. 10.1074/jbc.RA120.013623 PubMed 33268376