Skip to main content
Addgene

Myo 9 Avi+Flag
(Plasmid #134969)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134969 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFast Bac 1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4673
  • Total vector size (bp) 10413
  • Modifications to backbone
    Avi and Flag tag
  • Vector type
    Insect Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Myo 9
  • Alt name
    Hum 7, Myo IX
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    5740
  • Entrez Gene
    hum-7 (a.k.a. CELE_F56A6.2)
  • Promoter Polyhedrin
  • Tags / Fusion Proteins
    • Avi (C terminal on insert)
    • Flag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bam HI (not destroyed)
  • 3′ cloning site Kpn I (not destroyed)
  • 5′ sequencing primer Polyhedrin forward AAATGATAACCATCTCGC
  • 3′ sequencing primer SV40pA-R GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Sequencing of the C. elegans Myo9 cDNA that was obtained by reverse transcription-PCR revealed that it differed from the HUM-7 amino acid sequence at two positions. Residues 608–615 (VSPISPFW) were missing, and residues 731KKSAG735 were replaced by 731KSESAG736. Our deduced Myo9 amino acid sequence changes matched perfectly with the predicted Myo9 sequences for Caenorhabditis briggsae and Caenorhabditis remanei.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Myo 9 Avi+Flag was a gift from Martin Bähler (Addgene plasmid # 134969 ; http://n2t.net/addgene:134969 ; RRID:Addgene_134969)
  • For your References section:

    Head of myosin IX binds calmodulin and moves processively toward the plus-end of actin filaments. Liao W, Elfrink K, Bahler M. J Biol Chem. 2010 Aug 6;285(32):24933-42. doi: 10.1074/jbc.M110.101105. Epub 2010 Jun 10. 10.1074/jbc.M110.101105 PubMed 20538589