GFP-Myo 19
(Plasmid
#134987)
-
PurposeExpression of human Myo 19 in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134987 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4668
- Total vector size (bp) 7590
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMyo 19
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2922
-
GenBank IDAK 304073
-
Entrez GeneMYO19 (a.k.a. MYOHD1)
- Promoter CMV IE
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bgl II (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer EGFP-C CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer SV40pA-R GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This article is published:
Stefanie J. Oeding, Katarzyna Majstrowicz, Xiao-Ping Hu, Vera Schwarz, Angelika Freitag, Ulrike Honnert, Petra Nikolaus, Martin Bähler
Journal of Cell Science 2018 131: jcs219469 doi: 10.1242/jcs.219469 Published 10 September 2018
The Myo 19 cDNA was obtained from NITE Biological Resource Center (NBRC), Japan.
cDNA clone AK304073/FLJ61052/TRACH3006685
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-Myo 19 was a gift from Martin Bähler (Addgene plasmid # 134987 ; http://n2t.net/addgene:134987 ; RRID:Addgene_134987) -
For your References section:
Identification of Miro1 and Miro2 as mitochondrial receptors for myosin XIX. Oeding SJ, Majstrowicz K, Hu XP, Schwarz V, Freitag A, Honnert U, Nikolaus P, Bahler M. J Cell Sci. 2018 Sep 10;131(17). pii: jcs.219469. doi: 10.1242/jcs.219469. 10.1242/jcs.219469 PubMed 30111583