GFP-Myo 19
(Plasmid #134987)

• Purpose: Expression of human Myo 19 in mammalian cells.
• Depositing Lab: Martin Bähler
• Depositing Organization: Universität Münster
  Located in Germany
• Publication: Oeding et al J Cell Sci. 2018 Sep 10;131(17). pii: jcs.219469. doi: 10.1242/jcs.219469.
• Citations: 2 Articles

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4668
• Total vector size (bp): 7590
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Myo 19
• Species: H. sapiens (human)
• Insert Size (bp): 2922
• GenBank ID: AK 304073
• Entrez Gene: MYO19 (a.k.a. MYOHD1)
• Promoter: CMV IE
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Bgl II (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: EGFP-C CATGGTCCTGCTGGAGTTCGTG
• 3′ sequencing primer: SV40pA-R GAAATTTGTGATGCTATTGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This article is published:
Stefanie J. Oeding, Katarzyna Majstrowicz, Xiao-Ping Hu, Vera Schwarz, Angelika Freitag, Ulrike Honnert, Petra Nikolaus, Martin Bähler
Journal of Cell Science 2018 131: jcs219469 doi: 10.1242/jcs.219469 Published 10 September 2018

The Myo 19 cDNA was obtained from NITE Biological Resource Center (NBRC), Japan.
cDNA clone AK304073/FLJ61052/TRACH3006685

DNA (Catalog # 134987-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 134987-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.