Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

GFP-Myo 19
(Plasmid #134987)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 134987 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4668
  • Total vector size (bp) 7590
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Myo 19
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2922
  • GenBank ID
    AK 304073
  • Entrez Gene
    MYO19 (a.k.a. MYOHD1)
  • Promoter CMV IE
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl II (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer EGFP-C CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer SV40pA-R GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This article is published:
Stefanie J. Oeding, Katarzyna Majstrowicz, Xiao-Ping Hu, Vera Schwarz, Angelika Freitag, Ulrike Honnert, Petra Nikolaus, Martin Bähler
Journal of Cell Science 2018 131: jcs219469 doi: 10.1242/jcs.219469 Published 10 September 2018

The Myo 19 cDNA was obtained from NITE Biological Resource Center (NBRC), Japan.
cDNA clone AK304073/FLJ61052/TRACH3006685

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-Myo 19 was a gift from Martin Bähler (Addgene plasmid # 134987 ; http://n2t.net/addgene:134987 ; RRID:Addgene_134987)
  • For your References section:

    Identification of Miro1 and Miro2 as mitochondrial receptors for myosin XIX. Oeding SJ, Majstrowicz K, Hu XP, Schwarz V, Freitag A, Honnert U, Nikolaus P, Bahler M. J Cell Sci. 2018 Sep 10;131(17). pii: jcs.219469. doi: 10.1242/jcs.219469. 10.1242/jcs.219469 PubMed 30111583