pLKO5-SgHottip-GFP-CRISPRi
(Plasmid
#134989)
-
PurposedCas9-mediated inactivation of HOTTIP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134989 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO5.sgRNA.EFS.GFP
-
Backbone manufacturerBenjamin Ebert LAB
- Backbone size w/o insert (bp) 7408
- Total vector size (bp) 7428
-
Modifications to backboneBsmBI cut for SgRNA insert
-
Vector typeMammalian Expression, Bacterial Expression, Lentiviral
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHOTTIP
-
Alt nameHOXA-AS6
-
gRNA/shRNA sequenceGCGCGGGTCTGGGCCCCACT
-
SpeciesH. sapiens (human)
-
GenBank IDNC_000007.14
-
Entrez GeneHOTTIP (a.k.a. HOXA-AS6, HOXA13-AS1, NCRNA00213)
- Promoter U6
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO5-SgHottip-GFP-CRISPRi was a gift from Suming Huang (Addgene plasmid # 134989 ; http://n2t.net/addgene:134989 ; RRID:Addgene_134989) -
For your References section:
HOTTIP lncRNA Promotes Hematopoietic Stem Cell Self-Renewal Leading to AML-like Disease in Mice. Luo H, Zhu G, Xu J, Lai Q, Yan B, Guo Y, Fung TK, Zeisig BB, Cui Y, Zha J, Cogle C, Wang F, Xu B, Yang FC, Li W, So CWE, Qiu Y, Xu M, Huang S. Cancer Cell. 2019 Dec 9;36(6):645-659.e8. doi: 10.1016/j.ccell.2019.10.011. Epub 2019 Nov 27. 10.1016/j.ccell.2019.10.011 PubMed 31786140