Skip to main content

pLKO5-SgHottip-GFP-CRISPRa
(Plasmid #134990)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134990 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO5.sgRNA.EFS.GFP
  • Backbone manufacturer
    Benjamin Ebert LAB
  • Backbone size w/o insert (bp) 7408
  • Total vector size (bp) 7428
  • Modifications to backbone
    BsmBI cut for SgRNA insert
  • Vector type
    Mammalian Expression, Bacterial Expression, Lentiviral
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HOTTIP
  • Alt name
    HOXA-AS6
  • gRNA/shRNA sequence
    GGCCGCGCACCATTCACCCG
  • Species
    H. sapiens (human)
  • GenBank ID
    NC_000007.14
  • Entrez Gene
    HOTTIP (a.k.a. HOXA-AS6, HOXA13-AS1, NCRNA00213)
  • Promoter U6
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO5-SgHottip-GFP-CRISPRa was a gift from Suming Huang (Addgene plasmid # 134990 ; http://n2t.net/addgene:134990 ; RRID:Addgene_134990)
  • For your References section:

    HOTTIP lncRNA Promotes Hematopoietic Stem Cell Self-Renewal Leading to AML-like Disease in Mice. Luo H, Zhu G, Xu J, Lai Q, Yan B, Guo Y, Fung TK, Zeisig BB, Cui Y, Zha J, Cogle C, Wang F, Xu B, Yang FC, Li W, So CWE, Qiu Y, Xu M, Huang S. Cancer Cell. 2019 Dec 9;36(6):645-659.e8. doi: 10.1016/j.ccell.2019.10.011. Epub 2019 Nov 27. 10.1016/j.ccell.2019.10.011 PubMed 31786140