Skip to main content

UPRT-mCh-Nluc-P2A-neo-UPRT
(Plasmid #135015)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135015 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 135015-D50 50 μg of DNA in Tris buffer $495
DNA 135015-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pUC19
  • Backbone manufacturer
    invitrogen
  • Backbone size w/o insert (bp) 2300
  • Total vector size (bp) 8357
  • Modifications to backbone
    No
  • Vector type
    Cryptosporidium Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    mCh-Nluc-P2A-neo
  • Species
    Synthetic
  • Promoter Cryptosporidium actin and enolase
  • Tag / Fusion Protein
    • mCherry and Nluc-neo

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGAGAGCTTTCAATCAGCTCAGAATGAGTTGGTTATAAACAGT
  • 3′ sequencing primer GTTATAGATTGCATGCGCTTAATTAATCAGAAGAATTCGTCAAGA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    UPRT 5'UTR
  • Species
    Cryptosporidium parvum

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ttacgccaagcttgcatgcctgcagagttataagcacca
  • 3′ sequencing primer ataaccaactcattctgagctgattgaaagctctcaattgagt
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    UPRT 3'UTR
  • Species
    Cryptosporidium parvum

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer attcttctgattaattaagcgcatgcaatctataactaattccaaa
  • 3′ sequencing primer cagtgaattcgagctcggtacccgggattatacttccttgctggtt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    UPRT-mCh-Nluc-P2A-neo-UPRT was a gift from David Sibley (Addgene plasmid # 135015 ; http://n2t.net/addgene:135015 ; RRID:Addgene_135015)
  • For your References section:

    A Stem-Cell-Derived Platform Enables Complete Cryptosporidium Development In Vitro and Genetic Tractability. Wilke G, Funkhouser-Jones LJ, Wang Y, Ravindran S, Wang Q, Beatty WL, Baldridge MT, VanDussen KL, Shen B, Kuhlenschmidt MS, Kuhlenschmidt TB, Witola WH, Stappenbeck TS, Sibley LD. Cell Host Microbe. 2019 Jun 18. pii: S1931-3128(19)30252-5. doi: 10.1016/j.chom.2019.05.007. 10.1016/j.chom.2019.05.007 PubMed 31231046